Worm CRISPR

This is a work in progress. For a published protocol, see Arribere et al. 2014 PDF. Also see the new protocols from Paix et al. 2016 PDF (PCR template info in Paix et al. 2014 PDF and protocols, and Cas9 Protein info in Paix et al. 2015 PDF and protocols).

Design guide RNAs. Can use a website, but really only need to find a GG as close as possible to where you want to edit. GGNGG probably works much better (Farboud et al. 2015 PDF). You will need the 19 nucleotides preceding NGG, and also the sticky ends to facilitate cloning. Order a pair of IDT oligos to use for cloning into DR274 [MN3055] plasmid following the example below:

Site in MN’s DR274 U6 [3055]

5’  ATGTTTGagagaccaaggatccgggtctcaGTTTTAG   3’

3’  TACAAACtctctggttcctaggcccagagtCAAAATC   5’

Guide #3 is on positive strand (cuts 10nt away from desired spot)

Genome:            CCAGTCTAAGCAATAAAAT TGG

Forward Oligo: 5’  TTT G CCAGTCTAAGCAATAAAAT         3’

Reverse Oligo: 3’       GGTCAGATTCGTTATTTTA CAAA   5’

(5’   AAAC ATTTTATTGCTTAGACTGG        3’)

Order from IDT as:

Guide3F    TTTGCCAGTCTAAGCAATAAAAT    25nm STD

Guide3R    AAACATTTTATTGCTTAGACTGG    25nm STD

Once the oligos come in, dilute them to 100uM in the tube, then dilute 1:10 into another tube to get 10uM. Anneal the two together at a final concentration of 2uM (4ul Fwd, 4ul Rev, 12ul water) on the anneal cycle “crispr primer anneal faster” or any way to slowly cool from 95C to 37C.

Digest the backbone (empty DR274 [MN3055]) with BsaI-HF. Make sure it is as complete as possible (e.g. overnight at 37C)

Water 41ul

Plasmid (~1ug) 3ul (of 334ng/ul miniprep)

CutSmart 10x buffer 5ul

BsaI-Hf 1ul

Purify the backbone, either by running on a 0.8% Low-Melt agarose gel (Sea-Plaq) and gel purifying, or, According to MN, running it over a DNA column is enough to lose the tiny insert. So as long as the digest is complete enough, this should work. Mine was at 3.4ng/ul.

Ligate the annealed oligos and the purified backbone, incubate at 15C for ~1hr. Also perform a control with only the backbone (no insert).

water                       13.5ul

backbone                    6ul          (at 3.4ng/ul)

10x NEB ligation buffer  2.5ul

annealed insert           2ul

NEB T4 DNA ligase           1ul

Transform into DH5alpha:

10-100ul competent cells

5ul ligation mix

vortex briefly

incubate 20-40 minutes on ice

heat shock 40 seconds at 42C (on Nick’s bench)

incubate on ice 10 minutes

Add 1ml SOC

incubate 1hr at 37C with rotation or light shaking

plate 100ul on LB+Kan at 37C and keep the remainder at 4C

Pick colonies and screen with colony PCR + BamHI digest (OPTIONAL)

PCR                1rxn           __rxns

water              8.4ul

10x Taq. buffer    1ul

10mM dNTPs         0.2ul

10uM primer M13F  0.2ul                5’-TGTAAAACGACGGCCAGT -3’       

10uM primer Rev    0.2ul                5’-CATTCACCAAAGCTCTATCCGAAC -3’

Template       colony

Taq                0.05ul

aliquot 10ul/well, add a colony to each well

Cycler

denature             95C         5min

denature             95C         30sec  <----

anneal               58C         60sec          | 35x

extend               68C         60sec     ----

extend               68C         5min

hold                 12C         hold

Digest          1rxn        __rxns

water                  4.3ul

10x cut smart buffer   0.5ul

BamHI-HF               0.2ul

PCR product            10ul

Aliquot 5ul

Incubate at 37C

Run out on 2% agarose gel, look for loss of cut site

Grow up guideRNA plasmid colonies overnight at 37C in 5ml LB with shaking

Miniprep from 3ml (expect 200-400ng/ul)

Double digest with BamHI and EcoNI

Digest                 1rxn       __rxns

water                  8.6ul

miniprep DNA           5ul

10x Cut Smart buffer   1ul

BamHI-HF               0.2ul

EcoNI                  0.2ul                                                             

aliquot 10ul

Incubate at 37C (4 hours was sufficient)

Run out on 0.8% agarose gel

Sequence 2 different minipreps of each guide, just to be sure

0.8ul miniprep (PNACL requests 500-1000ng per kb of plasmid)

3.2ul 1uM primer ZK30 (PNACL requests 3.2pmol of primer)

  5’-CATTCACCAAAGCTCTATCCGAAC -3’

  8ul water               (PNACL requests 12ul total volume)

• Also grow up and miniprep Cas9 plasmid [MN3143] and dpy-10 gRNA plasmid [3153 or 3102]
• Obtain ssDNA oligo to target location of dpy-10(cn64) lesion (homologous recombination (HR) template)
• Design and obtain (from IDT) ssDNA oligo to target your favorite gene (HR template)
• Make sure your oligo changes the PAM or otherwise prevents Cas9 re-cutting

Inject (here is an example 20ul recipe)

50 ng/ul Cas9 MN3075 [193.3ng/ul] -- 5.17ul

20ng/ul dpy-10 sgRNA MN3102 [223.6ng/ul] -- 1.79ul

500nM dpy-10 repair oligo -- 0.4ul

40ng/ul yfg-1 guide 1 [252ng/ul] -- 3.17ul

40ng/ul yfg-1 guide 2 [326ng/ul] -- 2.45ul

600nM yfg-1 repair oligo [25uM] -- 0.48ul

ddH2O -- 6.54ul

Note: yfg-1 is Your Favorite Gene

Pick Rol F1, use PCR or phenotype to identify hets

Pick non-Rol F2, use PCR or phenotype to identify homozygous edited worms

Sequence homozygous F2s